{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

{[ privateVectorMsg | boatFixI18n | translate ]}
×

Vector Summary

Vector ID:
VB010000-9444bdu
Vector Name:
Vector Type:
Mammalian shRNA Knockdown Lentiviral Vector   Guide 
Vector Size:
8137 bp
Viral Genome Size:
4662 bp undersized genome oversized genome
shRNA:
EGFP[shRNA#2]
Target Sequence:
ACGTCTATATCATGGCCGACA
Marker:
mCherry:T2A:Bsd
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information 주문 방법

  • Deliverable:
    Plasmid DNA solution
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax):
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart
Contact us for bulk order discount
Contact us for bulk order discount

price match program

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
RSV promoter 1-229 229 View Details
Delta5' LTR 230-410 181 View Details
misc_feature1 411-520 110 View Details
Psi 521-565 45 View Details
misc_feature2 566-1074 509 View Details
RRE 1075-1308 234 View Details
misc_feature3 1309-1802 494 View Details
cPPT 1803-1920 118 View Details
misc_feature4 1921-1926 6 View Details
U6 promoter 1927-2175 249 View Details
DeltaAgeI 2176-2177 2 View Details
EGFP[shRNA#2] 2178-2225 48 View Details
terminator2 2226-2230 5 View Details
EcoRI 2231-2236 6 View Details
misc_feature7 2237-2257 21 View Details
PGK promoter 2258-2762 505 View Details
misc_feature8 2763-2792 30 View Details
mCherry:T2A:Bsd 2793-3962 1170 View Details
misc_feature9 3963-3993 31 View Details
WPRE 3994-4591 598 View Details
misc_feature10 4592-4656 65 View Details
DeltaU3/3' LTR 4657-4891 235 View Details
misc_feature11 4892-4963 72 View Details
SV40 early pA 4964-5098 135 View Details
misc_feature12 5099-6051 953 View Details
Ampicillin 6052-6912 861 View Details
misc_feature13 6913-7082 170 View Details
pUC ori 7083-7671 589 View Details
misc_feature14 7672-8137 466 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

a71c777a3506cd40fbe6725f07d15635