{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

{[ privateVectorMsg | boatFixI18n | translate ]}
×

Vector Summary

Vector ID:
VB010000-9349nxf
Vector Name:
Vector Type:
Mammalian miR30-shRNA Knockdown Vector   Guide 
Vector Size:
6785 bp
Promoter:
EF1A
ORF:
mCherry
shRNA:
Scramble[miR30-shRNA]
Target Sequence:
ACCTAAGGTTAAGTCGCCCTCG
Marker:
EGFP/Puro
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information 주문 방법

  • Deliverable:
    Plasmid DNA solution
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax):
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart
Contact us for bulk order discount
Contact us for bulk order discount

price match program

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
attB4 1-21 21 View Details
EF1A 22-1200 1179 View Details
attB1 1201-1224 24 View Details
Kozak 1225-1230 6 View Details
mCherry 1231-1941 711 View Details
attB2 1942-1965 24 View Details
5' miR-30E 1966-2093 128 View Details
Scramble[miR30-shRNA] 2094-2156 63 View Details
3' miR-30E 2157-2286 130 View Details
attB3 2287-2307 21 View Details
misc_feature5 2308-2325 18 View Details
SV40 late pA 2326-2547 222 View Details
misc_feature5 2548-2550 3 View Details
CMV promoter 2551-3138 588 View Details
misc_feature6 3139-3169 31 View Details
EGFP/Puro 3170-4486 1317 View Details
misc_feature7 4487-4529 43 View Details
BGH pA 4530-4754 225 View Details
misc_feature5 4755-4949 195 View Details
pUC ori complement
(
4950-5538 )
589 View Details
misc_feature7 5539-5708 170 View Details
Ampicillin complement
(
5709-6569 )
861 View Details
misc_feature7 6570-6785 216 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

d5a3446bdda93bc3c12c139b3c4570fc