{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

{[ privateVectorMsg | boatFixI18n | translate ]}
×

Vector Summary

Vector ID:
VB010000-0021kwc
Vector Name:
Vector Type:
Mammalian shRNA Knockdown Adenoviral Vector   Guide 
Vector Size:
34981 bp
Viral Genome Size:
32899 bp undersized genome oversized genome
shRNA:
Scramble_shRNA#1
Target Sequence:
CCTAAGGTTAAGTCGCCCTCG
Marker:
mCherry
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information 주문 방법

  • Deliverable:
    Plasmid DNA solution
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax):
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart
Contact us for bulk order discount
Contact us for bulk order discount

price match program

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
5' ITR 1-103 103 View Details
misc_feature1 104-190 87 View Details
Ψ 191-370 180 View Details
misc_feature2 371-512 142 View Details
attB1 513-536 24 View Details
U6 promoter 537-785 249 View Details
DeltaAgeI 786-787 2 View Details
Scramble_shRNA#1 788-835 48 View Details
Terminator 836-840 5 View Details
EcoRI 841-846 6 View Details
undefinded19 847-865 19 View Details
hPGK promoter 866-1370 505 View Details
Kozak 1371-1376 6 View Details
mCherry 1377-2087 711 View Details
SV40 late pA 2088-2309 222 View Details
BamHI 2310-2315 6 View Details
attB2 2316-2339 24 View Details
misc_feature6 2340-2357 18 View Details
ΔAd5 2358-32796 30439 View Details
3' ITR 32797-32899 103 View Details
PacI 32900-32907 8 View Details
misc_feature7 32908-33122 215 View Details
pBR322 ori complement
(
33123-33711 )
589 View Details
misc_feature8 33712-33862 151 View Details
AmpiciIIin complement
(
33863-34723 )
861 View Details
misc_feature9 34724-34973 250 View Details
PacI 34974-34981 8 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

b4cfac148b588f55f592b4d3ad2ed53e