{[preMadeVectorInfo.same_seq_vectors.length]}

Vector Information

{[ privateVectorMsg | boatFixI18n | translate ]}
×

Vector Summary

Vector ID:
VB010000-9430hya
Vector Name:
Vector Type:
Mammalian shRNA Knockdown AAV Vector   Guide 
Vector Size:
5335 bp
Viral Genome Size:
2196 bp undersized genome oversized genome
shRNA:
Scramble[shRNA#1]
Target Sequence:
CCTAAGGTTAAGTCGCCCTCG
Marker:
TagBFP2
Plasmid Copy Number:
High
Antibiotic Resistance:
Ampicillin

Order Information 주문 방법

  • Deliverable:
    Plasmid DNA solution
  • Cloning Host Strain: {[ obj.cloning_host|boatFixI18n|translate ]}
Price: Price(No Tax): {[ obj.commodity.default_price | areaCurrency ]} {[ obj.commodity.price | areaCurrency ]} Estimated turnaround{[":"| puncTrans : pub.CFG.LANG]} {[ obj.commodity.turnaround_time ]} days In Stock
Price: Price(No Tax):
Price: Price(No Tax): Inquiry being processed
Added to My shopping cart
Contact us for bulk order discount
Contact us for bulk order discount

price match program

Vector Components

{[opt.name | boatFixI18nName:'boatComponent'|translate]}
{[opt.name | boatFixI18nName:'boatComponent'|translate]}
5' ITR 1-130 130 View Details
misc_feature1 131-136 6 View Details
U6 promoter 137-385 249 View Details
DeltaAgeI 386-387 2 View Details
Scramble[shRNA#1] 388-435 48 View Details
Terminator 436-440 5 View Details
EcoRI 441-446 6 View Details
misc_feature4 447-467 21 View Details
CMV promoter 468-1056 589 View Details
misc_feature5 1057-1086 30 View Details
TagBFP2 1087-1788 702 View Details
misc_feature6 1789-1832 44 View Details
SV40 late pA 1833-2054 222 View Details
misc_feature7 2055-2066 12 View Details
3' ITR complement
(
2067-2196 )
130 View Details
misc_feature 2197-2207 11 View Details
misc_feature8 2208-3287 1080 View Details
Ampicillin 3288-4148 861 View Details
misc_feature9 4149-4318 170 View Details
pUC ori 4319-4907 589 View Details
misc_feature10 4908-5324 417 View Details
misc_feature 5325-5335 11 View Details

{[ 'appVectorInfo.NOTE' | translate ]}: {[ 'appVectorInfo.COMPONENTS_FRONT' | translate ]}{[ 'appVectorInfo.BOLD_RED' | translate ]}{[ 'appVectorInfo.COMPONENTS_AFTER' | translate ]}

9b8107757598028ba48f5f8e52095ecd
디자인 서포트 의뢰하기