gRNA Sequences

VectorBuilder offers many popular vector components that users can choose from when designing their vectors. The tables below provide detailed information on these popular components, which are listed separately by category.
Popular gRNA
Name Guide Sequence Target Gene Target Position References Sequence
Scramble[gRNA#1] GTGTAGTTCGACCATTCGTG None in human and mouse Engineered by VectorBuilder View
Scramble[gRNA#2] GTTCAGGATCACGTTACCGC None in human and mouse Engineered by VectorBuilder View
Scramble[SagRNA#1] GTGTAGTTCGACCATTCGTG None in human and mouse Engineered by VectorBuilder View
Scramble[SagRNA#2] GTTCAGGATCACGTTACCGC None in human and mouse Engineered by VectorBuilder View
Scramble[msgRNA#1] GTGTAGTTCGACCATTCGTG None in human and mouse Engineered by VectorBuilder View
Scramble[msgRNA#2] GTTCAGGATCACGTTACCGC None in human and mouse Engineered by VectorBuilder View
EGFP[gRNA#1] GGGCGAGGAGCTGTTCACCG EGFP 12-31 Science. 343:84 (2014) View
EGFP[gRNA#2] GAAGTTCGAGGGCGACACCC EGFP 339-358 Science. 343:84 (2014) View
ROSA26[gRNA#1] CGCCCATCTTCTAGAAAGAC Mouse ROSA26 locus 1st intron Designed by VectorBuilder View
AAVS1[gRNA#1] GGGGCCACTAGGGACAGGAT human AAVS1 locus Human AAVS1 locus Science. 339:823 (2013) View
EMX1[SagRNA#1] GGCCTCCCCAAAGCCTGGCCA Human EMX1 3rd exon Engineered by VectorBuilder View
Scramble[msSagRNA#1] GTGTAGTTCGACCATTCGTG None in human and mouse Engineered by VectorBuilder View
Scramble[msSagRNA#2] GTTCAGGATCACGTTACCGC None in human and mouse Engineered by VectorBuilder View
ttTi5605[gRNA#1] GATATCAGTCTGTTTCGTAA C. elegans ttTi5605 locus Adjacent to the ttTi5605 Mos1 insertion site on chromosome II Nat Methods. 10:1028 (2013) View
나의 벡터 디자인하기 디자인 서포트 의뢰하기